Hai cercato la traduzione di gentamycin da Inglese a Francese

gentamycin
gentamycine

gentamycin sulfate
gentamycine

gentamycin sulfate (product)
gentamicine

gentamycin concentration: 1 mg/ml.
concentration de gentamycine: 1 mg/ml.

the reference compound used was gentamycin.
le composé de référence utilisé est la gentamycine.

amounts of gentamycin: 1, 10 and 20 mg.
quantités de gentamycine: l, l0 et 20 mg.

gentamycin is added at a concentration of 0.2 mg/ml.
de la gentamicine est ajoutée à une concentration de 0,2mg/ml.

100 mg/l gentamycin sulfate; h. atp presursors : 1.
100 mg/l de sulfate de gentamycine ; h. des précurseurs de l'atp : 1.

the gentamycin remaining in the liposomes is measured at various times.
la gentamycine restant dans les liposomes est mesurée à différents temps.

he has not been on the vancyomycin or gentamycin since receiving stem cells.
il a cessé de prendre vancyomycin ou gentamycine depuis qu'il bénéficie cellules souches.

the effects of active infection could be prevented by treatment with gentamycin.
un traitement à la gentamicine peut prévenir les effets de l'infection active.

for injection into mice, gentamycin is added at a concentration of 0.2 mg/ml.
pour l'injection aux souris, de la gentamicine est ajoutée à une concentration de 0,2 mg/ml.

antibiotics were changed to nafcillin and gentamycin, and intravenous acyclovir was added on 23 december.
on a modifié l'antibiothérapie et administré de la nafcilline et de la gentamycine; de l'acyclovir par voie intraveineuse a été ajouté le 23 décembre.

the mem medium (ref. 0410265), the glutamine and the gentamycin are from gibco.
le milieu mem (réf.0410265), la glutamine et la gentamycine viennent de chez gibco.

on the tenth day, necroses are markedly greater in rabbits which have received gentamycin sulphate alone.
au dixième jour, les nécroses sont nettement plus importantes chez les lapins ayant reçu le sulfate de gentamycine seul.

in the tris-hcl 7.5 buffer, the addition of gentamycin changes the volume of the liposomes.
dans le tampon tris-hcl ph 7,5, l'addition de gentamycine modifie le volume des liposomes.

2. insertion of gentamycin resistance gene (gene aacc1) coupled to the second recombination sequence attp.
amorce attp eco-nhe+ : 5 'ggaattccggctagccgcgctaatgctctgttacagl ' ecori sphi amorce attp kpn-: 5' ggggtaccccatcaaataatgattttattt 3' kpnl 2.

ia). 0.998m sulfated gentamycin was titrated in accordance with the same procedure (fig. ib).
la gentamycine sulfatée 0.998m a été titrée selon le même procédé (fig. lb).

example 5 hip spacer e1 hip spacer e1 is constructed using a shank obtained from cement c1 containing gentamycin and a head obtained from cement c2 containing vancomycin.
exemple 5 : espaceur de hanche el l'espaceur de hanche el est fabriqué à l'aide d'une tige obtenue à l'aide du ciment cl contenant de la gentamicine, et d'une tête obtenue à l'aide du ciment c2 contenant de la vancomycine.

gentamycin concentration: 1 mg/ml. ph of glutamic acid: 3; 4.5; 7.5.
concentration de gentamycine: l mg/ml. ph de l'acide glutamique: 3; 4,5; 7,5.