전문 번역가, 번역 회사, 웹 페이지 및 자유롭게 사용할 수 있는 번역 저장소 등을 활용합니다.
"bej " company
"bej " company
마지막 업데이트: 2016-09-30
사용 빈도: 1
품질:
경고: 보이지 않는 HTML 형식이 포함되어 있습니다
the reguirements and codes of the rmf are taken as bej-ng identical to those of the imdg-code.
france les prescriptions et les codes du rmf sont considérés comme étant identiques à ceux du code imdg.
마지막 업데이트: 2014-02-06
사용 빈도: 1
품질:
primer pair name primer sequence amplicon size (bp) reference tdh-l tdh-r 5'gtaaaggtctctgacttttggac3' 5'tggaatagaaccttcatcttcacc3' 270 bej, 1999 (8.1) trh-l trh-r 5' ttggcttcgatattttcagtatct 3' 5'cataacaaacatatgcccatttcc3' 486 bej, 1999 (8.1) vp33 vp32 (r72h target) 5'tgcgaattcgatagggtgttaacc3' 5'cgaatccttgaacatacgcagc3' 387 or 320 robert-pillot, a. et. al., 2002 (8.5) and lee, c-y., et.al., 1995 (8.4)
nom de la paire d'amorces séquence de l'amorce taille de l'amplicon (pb) référence tdh-l tdh-r 5'gtaaaggtctctgacttttggac3' 5'tggaatagaaccttcatcttcacc3' 270 bej, 1999 (8.1) trh-l trh-r 5' ttggcttcgatattttcagtatct 3' 5'cataacaaacatatgcccatttcc3' 486 bej, 1999 (8.1) vp33 vp32 (cible r72h) 5'tgcgaattcgatagggtgttaacc3' 5'cgaatccttgaacatacgcagc3' 387 ou 320 robert-pillot, a. et. al., 2002 (8.5) et lee, c-y., et.al., 1995 (8.4)
마지막 업데이트: 2015-05-14
사용 빈도: 1
품질: