İnsan çevirisi örneklerinden çeviri yapmayı öğrenmeye çalışıyor.
Profesyonel çevirmenler, işletmeler, web sayfaları ve erişimin serbest olduğu çeviri havuzlarından.
"bej " company
"bej " company
Son Güncelleme: 2016-09-30
Kullanım Sıklığı: 1
Kalite:
Uyarı: Görünmez HTML biçimlendirmesi içeriyor
the reguirements and codes of the rmf are taken as bej-ng identical to those of the imdg-code.
france les prescriptions et les codes du rmf sont considérés comme étant identiques à ceux du code imdg.
Son Güncelleme: 2014-02-06
Kullanım Sıklığı: 1
Kalite:
primer pair name primer sequence amplicon size (bp) reference tdh-l tdh-r 5'gtaaaggtctctgacttttggac3' 5'tggaatagaaccttcatcttcacc3' 270 bej, 1999 (8.1) trh-l trh-r 5' ttggcttcgatattttcagtatct 3' 5'cataacaaacatatgcccatttcc3' 486 bej, 1999 (8.1) vp33 vp32 (r72h target) 5'tgcgaattcgatagggtgttaacc3' 5'cgaatccttgaacatacgcagc3' 387 or 320 robert-pillot, a. et. al., 2002 (8.5) and lee, c-y., et.al., 1995 (8.4)
nom de la paire d'amorces séquence de l'amorce taille de l'amplicon (pb) référence tdh-l tdh-r 5'gtaaaggtctctgacttttggac3' 5'tggaatagaaccttcatcttcacc3' 270 bej, 1999 (8.1) trh-l trh-r 5' ttggcttcgatattttcagtatct 3' 5'cataacaaacatatgcccatttcc3' 486 bej, 1999 (8.1) vp33 vp32 (cible r72h) 5'tgcgaattcgatagggtgttaacc3' 5'cgaatccttgaacatacgcagc3' 387 ou 320 robert-pillot, a. et. al., 2002 (8.5) et lee, c-y., et.al., 1995 (8.4)
Son Güncelleme: 2015-05-14
Kullanım Sıklığı: 1
Kalite: