您搜索了: scramble (法语 - 英语)

scramble
scramble

- formule scramble à 4 joueurs.
- 4 player scramble.

appelons le premier scénario scramble (ruée).
let’s call the first scenario scramble .

20/6/98 : la version beta 4 de scramble
20/6/98 : the beta 4 version of scramble

le scramble est la formule de la complémentarité entre les joueurs d'une même équipe.
the scramble complements the players in a team.

enfants pourraient s'amuser en jouant sur la plage, la plongée en apnée et roches scramble.
children could have fun playing on the beach, snorkeling and rocks scramble.

on propose également d'officialiser la formule du tee scramble prenant en compte les handicaps de 2 à 5 joueurs par groupe
legitimizing tee scramble handicaps of 2 to 5 players is also advocated

l'information scramble est de façon plus générale fournie par un circuit de décodage d'adresse du composant.
the information scramble is more generally given by an address decoding circuit of the component.

hermida, a., « online scramble for music downloads », bbc news online, le 19 janvier 2004.
hermida, a., online scramble for music downloads, bbc news online, january 19, 2004.

the scramble for northwest coast artifacts (1985); assemblée des premières nations et association des musées canadiens, turning the page:
the scramble for northwest coast artifacts (1985); assembly of first nations and canadian museums association, turning the page:

**(4) momotaro : inclus dans "scramble" 1, 2 (asin:b001hqlv36, b001kem0gm).
**(4) momotaro: included in "scramble" 1, 2(asin:b001hqlv36, b001kem0gm).

cette version révisée du système, appelée content scramble system ("css"), est alors devenue la technique de base de la protection des dvd.
this revised version of the technology, called the content scramble system ("css"), thus became the technology upon which protection of dvd video would be built.

l'arni "scramble", ou aléatoire, de séquence aagcgcgcΠtgtaggattcg, a été choisi pour nliybrider aucune séquence connue du génome humain.
the “scramble”, or random, irna of sequence aagcgcgctttgtaggattcg, was chosen so as not to hybridize any known sequence of the human genome.

le 22 août, il participe à l'édition smackdown dans la bataille royale de qualification pour le "scramble match" à wwe unforgiven, mais se fera éliminer.
on the august 22 episode of "smackdown", goldman was a participant in the 10-man battle royal match to determine a qualifier for the wwe championship scramble match at unforgiven.

lors de the bash 2009, il affronte tommy dreamer, christian, jack swagger et mark henry pour le ecw championship dans un "scramble match" mais tommy dreamer conserve son titre.
at the bash, he participated in a championship scramble match for the ecw championship, which also included christian, jack swagger and mark henry, however the defending champion tommy dreamer retained.

dispositif commutable et à fonctionnement indépendant pour transformer un signal en signal aléatoire et inversement (scrambler et descrambler).
switchable free running scrambler and descrambler arrangement.