Imparare a tradurre dagli esempi di traduzione forniti da contributi umani.
Da traduttori professionisti, imprese, pagine web e archivi di traduzione disponibili gratuitamente al pubblico.
impatiens necrotic spot virus
impatiens necrotic spot virus insv
Ultimo aggiornamento 2014-12-09
Frequenza di utilizzo: 1
Qualità:
Attenzione: Questo allineamento potrebbe essere errato.
Eliminalo se ritieni che sia così.
beet necrotic yellow vein furovirus
rhizomania virus
Ultimo aggiornamento 2013-06-12
Frequenza di utilizzo: 1
Qualità:
red clover necrotic mosaic virus
red clover necrotic mosaic virus
Ultimo aggiornamento 2014-12-09
Frequenza di utilizzo: 2
Qualità:
Attenzione: Questo allineamento potrebbe essere errato.
Eliminalo se ritieni che sia così.
elle se rapporte également à un procédé de détection du prunus necrotic ringspot virus dans des végétaux au moyen de ces primers.
it also relates to a method for detection of prunus necrotic ringspot virus in plants by using said primers.
Ultimo aggiornamento 2014-12-03
Frequenza di utilizzo: 1
Qualità:
mise au point d'une trousse de diagnostic contre la protÉine d'enveloppe recombinÉe du prunus necrotic ringspot virus
development of diagnostic kit against the recombinant coat protein of prunus necrotic ringspot virus
Ultimo aggiornamento 2014-11-25
Frequenza di utilizzo: 4
Qualità:
the sd. - the solvent action of sodium hypochlorite on fixed and unfixed necrotic tissue. - oral surg oral med oral pathol.
the sd.—the solvent action of sodium hypochlorite on fixed and unfixed necrotic tissue.—oral surg oral med oral pathol.
Ultimo aggiornamento 2014-12-03
Frequenza di utilizzo: 1
Qualità:
hand re, smith ml, harrison jw. - analysis of the effect of dilution on the necrotic tissue dissolution property of sodium hypochlorite. - j endod.
hand r e, smith m l, harrison j w.—analysis of the effect of dilution on the necrotic tissue dissolution property of sodium hypochlorite.—j endod.
Ultimo aggiornamento 2014-12-03
Frequenza di utilizzo: 1
Qualità:
la présente invention concerne un jeu de primers de la séquence id 1 : primer en amont aactgcagatggtttgccgaatttgcaa et séquence id 2 : primer en aval gctctagactagatctcaagcaggtc utile pour détecter le prunus necrotic ringspot virus dans des végétaux. elle se rapporte également à un procédé de détection du prunus necrotic ringspot virus dans des végétaux au moyen de ces primers. elle concerne par ailleurs une trousse de diagnostic utile dans la détection de la protéine d'enveloppe du prunus necrotic ringspot dans des végétaux.
the present invention deals with a set of primers of sequence id 1: upstream primer aactgcagatggtttgccgaatttgcaa and sequence id 2: downstream primer gctctagactagatctcaagcaggtc useful for detection of prunus necrotic ringspot virus in plants. it also relates to a method for detection of prunus necrotic ringspot virus in plants by using said primers. further the invention also relates to a diagnostic kit useful for detection of coat protein of prunus necrotic ringspot in plants.
Ultimo aggiornamento 2011-07-27
Frequenza di utilizzo: 1
Qualità: