Hai cercato la traduzione di afel da Inglese a Francese

quel avenir pour les femmes et les enfants dans ce pays ? afel bocoum :
quel avenir pour les femmes et les enfants dans ce pays ?

with a view to improving the construction, the sequence upstream of the start codon was mutated at two positions by pcr, with the following pair of primers, in order to remove two open reading frames upstream of the gfat1 gene: start xbal 5′ aatctagattcatgctcgagcggccgccagtgt (seq id no:16) gattgatatc 3′ end afei 5′ atttttatcagagcgctgggggtggctattgac (seq id no:17) agg 3′ according to the protocol: 94° c. 2 minutes, then 30 cycles (94° c. 15 seconds, 55° c. 30 seconds, 68° c. 1 minute) followed by a 1 minute's polymerization at 68° c. and returning to 4° c. the pcr fragment obtained, containing the two mutations, was purified on seaplaque gel (tebu) at 0.7% then digested by xbai and afel in order to replace its homologue in pfastbac-gfat-his6 in order to produce the donor plasmid pfastbac-gfat-his6-2orf to be used for transposition into the dh10bac cells (life technologies ltd).
en vue d'améliorer la construction, la séquence en amont du codon de démarrage a été mutée sur deux positions par pcr, avec la paire d'amorces suivante, afin d'enlever deux phases de lecture ouvertes en amont du gène gfatl : - start xbal 5' aatctagattcatgctcgagcggccgccagtgtgattgatatc 3' (seq id no : 16) - end afel 5 * atttttatcagagcgctgggggtggctattgacagg 3' (seq id no : 17) selon le protocole : 94°c 2 min, puis 30 cycles (94°c 15 sec, 55°c 30 sec, 68°c 1 min) suivis d'une polymérisation de 1 min à 68°c et retour à 4°c. le fragment de pcr obtenu, contenant les deux mutations, a été purifié sur gel seaplaque (tebu) à 0,7% puis digéré par xbal et afel pour remplacer son homologue dans pfastbac-gfat-his6 afin de donner le plasmide donneur pfastbac-gfat-his6-2orf servant à la transposition dans les cellules dhlobac (life technologies ltd).