Sie suchten nach: tctcccagcgtgcgccat (Französisch - Englisch)

Computer-Übersetzung

Versucht aus den Beispielen menschlicher Übersetzungen das Übersetzen zu lernen.

French

English

Info

French

tctcccagcgtgcgccat

English

 

von: Maschinelle Übersetzung
Bessere Übersetzung vorschlagen
Qualität:

Menschliche Beiträge

Von professionellen Übersetzern, Unternehmen, Websites und kostenlos verfügbaren Übersetzungsdatenbanken.

Übersetzung hinzufügen

Französisch

Englisch

Info

Französisch

composition de vaccin selon la revendication 8, dans laquelle le motif cpg comprend tctcccagcgtgcgccat ou tccatgacgttcctgacgtt.

Englisch

the vaccine composition as claimed in claim 8, wherein the cpg motif comprises tctcccagcgtgcgccat or tccatgacgttcctgacgtt.

Letzte Aktualisierung: 2014-12-04
Nutzungshäufigkeit: 2
Qualität:

Französisch

composition d'adjuvant immunitaire comprenant (a) une saponine possédant une activité d'adjuvant immunitaire ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle l'oligonucléotide immunostimulant ne fait pas partie d'un vecteur de vaccin à adn, ou (a) une saponine possédant une activité d'adjuvant immunitaire, dans laquelle la saponine est dérivée de quillaja saponaria ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle la saponine est un ou plusieurs parmi qs-7, qs-17 ou qs-18 sensiblement pures, ou (a) une saponine possédant une activité d'adjuvant immunitaire ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle l'oligonucléotide immunostimulant comprend tctcccagcgtgcgccat ou tccatgacgttcctgacgtt, ou (a) une saponine possédant une activité d'adjuvant immunitaire, dans laquelle la saponine est une saponine chimiquement modifiée ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé.

Englisch

an immune adjuvant composition comprising (a) a saponin possessing immune adjuvant activity; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the immunostimulatory oligonucleotide is not a part of a dna vaccine vector, or (a) a saponin possesing immune adjuvant activity, wherein the saponin is derived from quillaja saponaria ; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the saponin is one or more substantially pure qs-7, qs-17 or qs-18, or (a) a saponin possessing immune adjuvant activity; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the immunostimulatory oligonucleotide comprises or (a) a saponin possessing immune adjuvant activity, wherein the saponin is chemically modified saponin; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide.

Letzte Aktualisierung: 2014-12-04
Nutzungshäufigkeit: 2
Qualität:

Eine bessere Übersetzung mit
7,781,520,244 menschlichen Beiträgen

Benutzer bitten jetzt um Hilfe:



Wir verwenden Cookies zur Verbesserung Ihrer Erfahrung. Wenn Sie den Besuch dieser Website fortsetzen, erklären Sie sich mit der Verwendung von Cookies einverstanden. Erfahren Sie mehr. OK