Results for tctcccagcgtgcgccat translation from French to English

Computer translation

Trying to learn how to translate from the human translation examples.

French

English

Info

French

tctcccagcgtgcgccat

English

 

From: Machine Translation
Suggest a better translation
Quality:

Human contributions

From professional translators, enterprises, web pages and freely available translation repositories.

Add a translation

French

English

Info

French

composition de vaccin selon la revendication 8, dans laquelle le motif cpg comprend tctcccagcgtgcgccat ou tccatgacgttcctgacgtt.

English

the vaccine composition as claimed in claim 8, wherein the cpg motif comprises tctcccagcgtgcgccat or tccatgacgttcctgacgtt.

Last Update: 2014-12-04
Usage Frequency: 2
Quality:

French

composition d'adjuvant immunitaire comprenant (a) une saponine possédant une activité d'adjuvant immunitaire ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle l'oligonucléotide immunostimulant ne fait pas partie d'un vecteur de vaccin à adn, ou (a) une saponine possédant une activité d'adjuvant immunitaire, dans laquelle la saponine est dérivée de quillaja saponaria ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle la saponine est un ou plusieurs parmi qs-7, qs-17 ou qs-18 sensiblement pures, ou (a) une saponine possédant une activité d'adjuvant immunitaire ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle l'oligonucléotide immunostimulant comprend tctcccagcgtgcgccat ou tccatgacgttcctgacgtt, ou (a) une saponine possédant une activité d'adjuvant immunitaire, dans laquelle la saponine est une saponine chimiquement modifiée ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé.

English

an immune adjuvant composition comprising (a) a saponin possessing immune adjuvant activity; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the immunostimulatory oligonucleotide is not a part of a dna vaccine vector, or (a) a saponin possesing immune adjuvant activity, wherein the saponin is derived from quillaja saponaria ; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the saponin is one or more substantially pure qs-7, qs-17 or qs-18, or (a) a saponin possessing immune adjuvant activity; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the immunostimulatory oligonucleotide comprises or (a) a saponin possessing immune adjuvant activity, wherein the saponin is chemically modified saponin; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide.

Last Update: 2014-12-04
Usage Frequency: 2
Quality:

Get a better translation with
7,790,827,081 human contributions

Users are now asking for help:



We use cookies to enhance your experience. By continuing to visit this site you agree to our use of cookies. Learn more. OK