Je was op zoek naar: tctcccagcgtgcgccat (Frans - Engels)

Computervertaling

Via de voorbeelden van menselijke vertaling trachten te leren vertalen.

French

English

Info

French

tctcccagcgtgcgccat

English

 

Van: Machinevertaling
Stel een betere vertaling voor
Kwaliteit:

Menselijke bijdragen

Van professionele vertalers, bedrijven, webpagina's en gratis beschikbare vertaalbronnen.

Voeg een vertaling toe

Frans

Engels

Info

Frans

composition de vaccin selon la revendication 8, dans laquelle le motif cpg comprend tctcccagcgtgcgccat ou tccatgacgttcctgacgtt.

Engels

the vaccine composition as claimed in claim 8, wherein the cpg motif comprises tctcccagcgtgcgccat or tccatgacgttcctgacgtt.

Laatste Update: 2014-12-04
Gebruiksfrequentie: 2
Kwaliteit:

Frans

composition d'adjuvant immunitaire comprenant (a) une saponine possédant une activité d'adjuvant immunitaire ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle l'oligonucléotide immunostimulant ne fait pas partie d'un vecteur de vaccin à adn, ou (a) une saponine possédant une activité d'adjuvant immunitaire, dans laquelle la saponine est dérivée de quillaja saponaria ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle la saponine est un ou plusieurs parmi qs-7, qs-17 ou qs-18 sensiblement pures, ou (a) une saponine possédant une activité d'adjuvant immunitaire ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle l'oligonucléotide immunostimulant comprend tctcccagcgtgcgccat ou tccatgacgttcctgacgtt, ou (a) une saponine possédant une activité d'adjuvant immunitaire, dans laquelle la saponine est une saponine chimiquement modifiée ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé.

Engels

an immune adjuvant composition comprising (a) a saponin possessing immune adjuvant activity; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the immunostimulatory oligonucleotide is not a part of a dna vaccine vector, or (a) a saponin possesing immune adjuvant activity, wherein the saponin is derived from quillaja saponaria ; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the saponin is one or more substantially pure qs-7, qs-17 or qs-18, or (a) a saponin possessing immune adjuvant activity; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the immunostimulatory oligonucleotide comprises or (a) a saponin possessing immune adjuvant activity, wherein the saponin is chemically modified saponin; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide.

Laatste Update: 2014-12-04
Gebruiksfrequentie: 2
Kwaliteit:

Krijg een betere vertaling met
7,781,519,953 menselijke bijdragen

Gebruikers vragen nu voor assistentie



Wij gebruiken cookies om u de best mogelijke ervaring op onze website te bieden. Door de website verder te gebruiken, geeft u toestemming voor het gebruik van cookies. Klik hier voor meer informatie. OK