Вы искали: tctcccagcgtgcgccat (Французский - Английский)

Компьютерный перевод

Обучается переводу с помощью примеров, переведенных людьми.

French

English

Информация

French

tctcccagcgtgcgccat

English

 

От: Машинный перевод
Предложите лучший перевод
Качество:

Переводы пользователей

Добавлены профессиональными переводчиками и компаниями и на основе веб-страниц и открытых баз переводов.

Добавить перевод

Французский

Английский

Информация

Французский

composition de vaccin selon la revendication 8, dans laquelle le motif cpg comprend tctcccagcgtgcgccat ou tccatgacgttcctgacgtt.

Английский

the vaccine composition as claimed in claim 8, wherein the cpg motif comprises tctcccagcgtgcgccat or tccatgacgttcctgacgtt.

Последнее обновление: 2014-12-04
Частота использования: 2
Качество:

Французский

composition d'adjuvant immunitaire comprenant (a) une saponine possédant une activité d'adjuvant immunitaire ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle l'oligonucléotide immunostimulant ne fait pas partie d'un vecteur de vaccin à adn, ou (a) une saponine possédant une activité d'adjuvant immunitaire, dans laquelle la saponine est dérivée de quillaja saponaria ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle la saponine est un ou plusieurs parmi qs-7, qs-17 ou qs-18 sensiblement pures, ou (a) une saponine possédant une activité d'adjuvant immunitaire ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé, dans laquelle l'oligonucléotide immunostimulant comprend tctcccagcgtgcgccat ou tccatgacgttcctgacgtt, ou (a) une saponine possédant une activité d'adjuvant immunitaire, dans laquelle la saponine est une saponine chimiquement modifiée ; et (b) un oligonucléotide immunostimulant comprenant au moins un dinucléotide cpg non méthylé.

Английский

an immune adjuvant composition comprising (a) a saponin possessing immune adjuvant activity; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the immunostimulatory oligonucleotide is not a part of a dna vaccine vector, or (a) a saponin possesing immune adjuvant activity, wherein the saponin is derived from quillaja saponaria ; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the saponin is one or more substantially pure qs-7, qs-17 or qs-18, or (a) a saponin possessing immune adjuvant activity; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide, wherein the immunostimulatory oligonucleotide comprises or (a) a saponin possessing immune adjuvant activity, wherein the saponin is chemically modified saponin; and (b) an immunostimulatory oligonucleotide comprising at least one unmethylated cpg dinucleotide.

Последнее обновление: 2014-12-04
Частота использования: 2
Качество:

Получите качественный перевод благодаря усилиям
7,783,717,716 пользователей

Сейчас пользователи ищут:



Для Вашего удобства мы используем файлы cookie. Факт перехода на данный сайт подтверждает Ваше согласие на использование cookies. Подробнее. OK